Team members: Jim McCreight (USDA, ARS), Shaker Kousik (USDA, ARS), Michael Mazourek (Cornell Univ.), Pat Wechter (USDA, ARS), Bill Wintermantel (USDA, ARS). View all tables and figures in pages 25-40 of the pdf version of this report.
Develop common genomic approaches and tools for cucurbits
Perform GBS analysis of PI collections, establish core populations, provide community resource for genome wide association studies (GWAS)
GBS of Melon, establish molecular-informed core populations
GBS analysis of the melon collection (2083 USDA, NPGS accessions, and selected heirloom and lines) emphasized correctly identifying their respective classification with regard to the division of the species into two subspecies, agrestis and melo, based upon the difference in ovary hair (Pitrat et al. 2000. Some comments on infraspecific classification of cultivars of melon. Acta Hort. 510:29–36.). For example, 73 (3.5 %) accessions had no subspecies designations in NPGS passport data. Other accessions were identified as ssp. melo, but were known in the literature to be ssp. agrestis, e.g., PI 414723.
- A manuscript is in preparation to report results of population structure analyses using a suite of tools, LD decay, Core collection selections, and GWAS using historical and project-generated data.
The melon core S1 production is well underway. About 150 members were selfed in 2019. The balance of the 384 member group is being selfed through summer 2020 with fruit from about 110 accessions harvested as of May 28. Seeds of each member will be increased by an industry partner for deposit in USDA, NPGS.
Endorna virus (CmEV) analysis of 42 C. melo ssp. agrestis var. texanus was continued in crosses with ‘Top Mark’ and among selected texanus accessions.
Genomic assisted breeding for disease resistance in melon
Powdery Mildew (Podosphaera xanthii) resistance in MR-1 x AY (Ananas Yoqne’am) RIL
Awaiting growth chamber space availability for Race 2 test.
Powdery Mildew (Podosphaera xanthii) resistance in Top Mark x PI 313970 F2:3
Resistance to race S was reported to be controlled by the single gene pm–S. The Race S isolate used in this test was previously identified/confirmed in a growth chamber test of powdery mildew race differentials. Due to the large number of F2:3 families evaluated (161), only one replication was completed. The susceptible check, Védrantais, was fully susceptible, while PI 313970 was about equally split between plants free of infection and those showing limited mycelial growth and sporulation (Table 2.1.2–1). A characteristic reaction of some PI 313970 individuals to powdery mildew is similar to the category 5 rating, but typically more restricted. Even if the 1 and 5 categories are considered resistant, the F2:3 segregation was an unacceptable fit to a 3 susceptible: 1 resistant ratio (F = 24.5983, P<0.001). The isolate may have become a mixture of races S and SD, which infects PI 313970. The four resistant families are starting points for introgression of race S/SD resistance to western U.S. shipper type cantaloupe.
Table 2.1.2–1. Reaction of Top Mark x PI 313970 F2:3 to cucurbit powdery mildew race S in a growth chamber experiment.
Entry |
n |
Disease severityz |
||
1 |
5 |
9 |
||
| F2:3 | 161 | 4 | 9 | 148 |
| PI 313970 | 7 | 4 | 3 | 0 |
| Védrantais | 9 | 0 | 0 | 9 |
zrated on a three-point scale where 1=no disease, 5= limited mycelial growth and sporulation, and 9=abundant growth and sporulation.
Two replicated field tests of cucurbit powdery mildew race differentials subjected to natural infection were planted in Imperial Valley. University of California, Desert Research and Extension Center, Holtville; watered 8 March 2018. The race present was similar to race 3 (Table 2.1.2–2).
Table 2.1.2–1. Reactions of 13 cucurbit powdery mildew race differentialsto natural infection in Imperial Valley at the University of California, Desert Research and Extension Center, Holtville, CA
Entry |
Mean disease reactionz |
Summary reaction |
| Iran H | 9 | S |
| Top Mark | 6.5 | S |
| Vedrantais | 9 | S |
| PMR 45 | 6.17 | S |
| PMR 5 | 4.67 | S |
| PMR 6 | 5.33 | S |
| WMR 29 | 4.5 | S |
| Edisto 47 | 2.5 | R |
| PI 414723 | 1.67 | R |
| MR-1 | 1 | R |
| PI 124111 | 1 | R |
| PI 124112 | 2.83 | R |
| PI 313970 | 1 | R |
zrated on a 1 (no disease) to 9 (>75 % of adaxial surface covered with hyphae and spores, numerous or coalesced colonies on the abaxial surface).
A second field test was planted in the Central Valley at University of California, Westside (Westside Research and Extension Center, Five Points; Planted 25 June 2018; insufficient infection to evaluate.
Downy mildew
Phenotyped resistance in the MR1 x AY RIL.
CYSDV
PI 313970 x Top Mark–Evaluated 200 F2:F3 progenies for phenotypic reaction and relative virus titer analyses in two field tests in Imperial Valley at the University of California, Desert Research and Extension Center, Holtville. The Spring test was watered 7 March and the Fall test was watered 16 August 2018. Infection by two viruses was confirmed: CYSDV and Cucurbit chlorotic yellows virus (CCYV). Their symptoms on melon are nearly identical. As a result virtually all plants exhibited foliar yellowing symptoms typical of CYSDV and CCYV. Phenotypic data (foliar yellowing) were not useful for mapping CYSDV resistance QTL, as plants resistant to CYSDV in the F2:3 population exhibited yellowing symptoms from CCYV infection. QTL analysis in both tests of the relative titer of CYSDV calculated from RT-qPCR data identified one locus on chromosome 5 that explained 34-38% of the variation in CYSDV titer. Our result confirmed the previous report of a CYSDV resistance QTL on chromosome 5 in TGR 1551 (PI 482420) based on yellowing symptoms and virus titer. Markers flanking this QTL can be utilized in marker assisted breeding of CYSDV-resistant melons.
CMV
Selfed progenies from four of the 25 advanced Cornell University CMV-resistant melon lines developed by M. Kyle-Jahn and H.M. Munger were evaluated in a field in a field planting at University of California, Westside Research and Extension Center (WSREC), 5-Points. Aphid-borne viruses such as CMV and WMV are common in this area. The test was watered June 25. The test was relatively free of melon aphid, which caused extensive damage in 2018, so the test provided a much better opportunity to evaluate the horticultural qualities of the lines (Table 2.1.2–3). CMV and WMV were present throughout the field. The border rows of ‘Golden Beauty Casaba’ exhibited pronounced symptoms from co-infection by CMV and WMV. The Cornell lines exhibited mild mosaic symptoms, and were negative for CMV and positive for WMV. Progenies from lines 17-4068-1 and 17-4069-2.2 yielded fruit closer to western U.S. shipper type than the other two lines. The canopy of 17-4069-2.2 was noticeably more open, than the other three lines, ‘Top Mark’ and ‘Greenflesh Honeydew’.
Table 2.1.2–3. Field notes of seven progenies from four Cornell University CMV-resistant melon breeding lines, 2019, University of California, Westside Research and Extension Center (WSREC), 5-Points, and comparison of fruit characters with U.S. western shipper type cantaloupe (‘Top Mark’) and ‘Greenflesh Honeydew’. Note: all Cornell lines exhibited mild virus mosaic symptoms determined to have resulted from infection by Watermelon mosaic virus (WMV).
Line |
ARS pedigree |
n plants |
Plant |
Size |
Flesh color |
|||||||
Sizez |
Covery |
Earliness |
Shape |
Net |
Vein tracts |
Ribbing |
Slip |
Blossom Scar |
||||
| 17-4068-1 | 38379 | 5 | 7 | globular | light | smooth | intermediate | no | large | orange | ||
| 38381 | 1 | 3 | globular | warts | smooth | superficial | ||||||
| 17-4069-2.2 | 38382 | 2 | 6 | open | early | globular | light | smooth | intermediate | no | medium | green |
| 38383 | 5 | 6 | open | early | elliptical | light | variable | intermediate | ||||
| 38384 | 1 | 6 | open | globular | light | variable | superficial | |||||
| 17-4074-2 | 38387 | 2 | 9 | flattened | variable | smooth | intermediate | no | medium | orange | ||
| 17-4075-21 | 38386 | 4 | 6 | elliptical | light | smooth | intermediate | ? | medium | orange | ||
| Top Mark | – | elliptical | heavy | none | none | yes | small | orange | ||||
| Greenflesh Honeydew | – | elliptical | none | none | none | no | small | green | ||||
z 1 to 9 scale, where 1 is very small and 9 covers a standard 80-inch bed.
yopen canopy exposed fruit to possible sunburn
xsegregated in 2018
Marker development and verification
Powdery and Downy Mildews
QTL have been identified for powdery mildew race 1 derived from MR-1 in the MR-1 x AY (Ananas Yoqne’am) RIL. KASP primers have been developed and currently being validated in the RIL.
QTL have been identified for sulfur tolerance derived from AY in the MR-1 x AY RIL. KASP primers have been developed and have been validated in the RIL. The top five KASP markers that both target and flank the genetic region of interests are being validated in an additional sulfur susceptible and resistant (tolerant) cultivars.
Identified QTL for downy mildew resistance in the MR-1 x AY RIL population.
In process of completing sequencing (short-read, long read, 10X genome and Pacbio) of MR-1 and Ananas Yoqne’am.
Fusarium wilt
KASP primers have been developed and validated in the recombinant inbred lines (MR-1 x AY) for QTL associated with Fusarium oxysporum f. sp melonis race 1 and race 2. The top five KASP markers that both target and flank the genetic region of interests are being validated in an additional population derived from MR-1.
CYSDV
A total of 1,038 GBS SNP markers were utilized to develop the genetic linkage mapping in MapDisto 2.0 (Lorieux, 2012) and the resulting maps contained 12 linkage groups corresponding 12 chromosomes of melon. Qgene 4.0 (Johanes and Nelson 2008) was used for QTL mapping analysis.
One QTL on chromosome 5 located at physical position of 22217535 bp was identified that explained ~16% of the variation in CYSDV titer for Fall 2018 (Fig 2, Table 1). The significant marker associated with this QTL is S5-22217535 and was significant at only α level 0.05. Another QTL on chromosome 3 was also identified at a physical position of 28571859 (R2 = 20%) which was significant at both α level 0.05 and 0.01 (Table 1).
Table 1: QTL identified in year 2018 and 2019.
Chromosome |
Year |
Significant markers |
Interval (cM) |
R2 |
Physical position (bp) |
LOD |
|||
| 5 | 2018 | S5-22217535z | 149.15 cM | 16 | 22217535 | 5.3 | |||
| 2019 | S5-20880639z,y | 145.31 cM | 35 | 20880639 | 8.12 | ||||
| 3 | 2018 | S3-28571859z,y | 218.81 cM | 20 | 28571859 | 6.7 | |||
zSignificant at alpha level 0.05.
Fig 2. Composite interval mapping of chr 5 (A) and chr 3 (B) showing significant CYSDV resistance QTL in the Top Mark x PI 313970 F2 populations in Fall of 2018. The x-axis represents the markers and the y-axis represents the LOD values. LOD threshold was calculated by 1000 permutations at a 0.05 and 0.01 significance level and are denoted by blue and green lines, respectively. The LOD and R2 values for chromosome 5 QTL are 5.74 and 16%. The LOD and R2 values for chr 3 QTL are 6.7 and 20%. The significant marker on chr 5 was S5-22217535 which is located at physical position of 20880639 bp and the significant marker on chr 3 was S3-28571859 located at physical position of 28571859.
Similarly, with 2019 fall data, a QTL was identified on the same chromosome 5 in proximity of 2018 QTL which is approximately 1.3 mb away from S5-22217535 (Fig 3, Table 1). The significant marker associated with this QTL is S5-20880639 that explained ~35% of the variation in CYSDV titer for Fall 2019 (Fig 1, Table 1). This QTL was significant at both α level 0.05 and 0.01.
Fig 3. Composite interval mapping of chr 5 showing significant CYSDV resistance QTL in the Top Mark x PI 313970 F2 populations in Fall of 2019. The x-axis represents the markers and the y-axis represents the LOD values. LOD threshold was calculated by 1000 permutations at a 0.05 significance level is denoted by blue line and at 0.01 is represented by green line. The LOD and R2 values for chromosome 5 QTL was 8.12 and 35%. The significant marker S5-20880639 is located at 20880639 bp on chr 5.
View figures 2 & 3 on page 47 of the pdf version of this report
Our result confirmed the previous report of a CYSDV resistance QTL on chromosome 5 in TGR 1551 (PI 482420) based on yellowing symptoms and virus titer (Palomares-Ríus et al., 2016). Markers flanking this QTL can be utilized in marker assisted breeding of CYSDV-resistant melons. This study showed the utility of molecular data for genetic analysis of resistance to one specific virus when co-infection by a second virus induces identical symptoms.
We searched the S5-20880639 marker sequence along with some other markers in proximity from http://cucurbitgenomics.org/JBrowse/ and designed the marker based on the single nucleotide polymorphism between two parents ‘Top Mark’ and PI 313970 as shown below. Parent specific sequence tagged site (STS) markers were developed for SNP marker S5-20880639 which served as a co-dominant marker (Fig 4). The PCR reaction parameter were optimized by increasing the annealing temperature to increase the specificity of the STS primers. Other primers did not perform well to differentiate the two parental lines. We will have to find another marker that works better and will have two flanking markers delimiting the QTL region of our interest.
| >chr5 chr5:20880052..20880995 (S5-20880639 sequence) |
| GAGGACAACAAACCACTGGTTGAAACAGAGGAAGAACCCCAACAGAAGGAAGAGGAGGTTGCTGAACCTC |
| CACCTCTAATAGAAACCCACGACCCAAGTGATCTTCTGGTAAGAA→TTTTCAGATAAAGCATTTTCTTGAC |
| ATGTTTAACTGCCTCTCCCATTACATCCAGTGATAATTTCCCATGCAGGGTCTGAATGAAATAAATCCCA |
| AAGCTGCAGAAATAGAAGAAAGCAATGCTTTAGCTCTTGCTATTGTTACAAATGGTAG/AGTTGTCCGCC |
| ATTTAGCTTTGTA←ATGTCTG/TAGCTTATTTTCCATGAAGAGTCTATCAGCGATGCAGCAACTACCTCTA |
| CTCTGGCACATCTTTTGTGTGTTTATTTGCAAATCATATAGACTGACAAAGTAAATTCAGAGTTGAAAAT |
| TCTATCTTTTCCAATTGTTGCAATTATAGAGGTTTTGTCCGTCCATTTATCTAATGAAGTTTTTAATTAT |
| ATGCAGGGAATGACCCATCTTCTTCAAATCGTGCATTGAGTGAAATTGGCGGTAGTGGTTGGGAGCTAGC |
| GCTTGTTACCACACCAAGCAATAATACTGGTCCTTCTGTCGAAGGCAGACTGGTTTTTCCCTTCCCCT |
Top Mark-specific primer (G/G allele)
20880639-F1: CTGCCTCTCCCATTACATCCAG
20880639-TM-R1: CAAAGCTAAATGGCGGACAACC
PI 313970-specific primer (TT allele)
20880639-F1: CTGCCTCTCCCATTACATCCAG
20880639-PI313-R1: CAAAGCTAAATGGCGGACAACT
View the sequence with color coding on page 48 of the pdf version of this report
Fig 4. Genotyping of ‘Top Mark’ and PI 313970 with TM specific and PI 313970-specific primers. The ‘Top Mark’-specific primers amplified only from TM and PI 313970 amplified only from PI 313970
View figure 4 on page 49 of the pdf version of this report
For further validation of this marker S5-20880639, we genotyped possible CYSDV resistance PI lines. The genotypes of PI 122847, PI 614213, PI 614185, PI 482431 and PI 116482 were all PI 313970-like (Table 2.2–1). However, the genotype AMES 26704, PI 123496, PI 116482 are ‘Top Mark’-like.
Since, the F1 of Top Mark x PI 123496 is ‘Top Mark’-like, PI 123496 must be in heterozygous state. We need to test more of the PI 123496 and F1 lines made with this PI 123496.
Table 2.2–1. Assay of PI 313970 marker flanking CYSDV resistance QTL.
CYSDV resistance source or progeny |
PI 313970-like markerz |
| F1PI 145594 x Impac | +/- |
| F1Top Mark x PI 123496 | – |
| PI 116482 | – |
| PI 122847 | + |
| PI 123496 | +/- |
| PI 145594 | + |
| PI 482431 | + |
| PI 614185 | + |
| PI 614213 | + |
z+= presence of marker, -= absence of marker, and +/-= heterozygote
We genotyped with this new marker (S5-20880639) eight F2:3 Top Mark x PI 313970 plants in eight different families that had low virus titer, and they were all PI 313970-like (Figure 5).
Figure 5. Eight individuals in eight F2:3 with low CYSDV titers possessed S5-20880639 marker present in PI 313970 but not in ‘Top Mark’. Conversley, ‘Top Mark’ primers were absent in the eight progeny plants.
View figure 5 on page 50 of the pdf version of this document
CMV
No progress to date.
CCYV–Cucurbit chlorotic yellows virus
During the summer of 2018, melon plants from a germplasm diversity study in the Imperial Valley, CA were found infected with Cucurbit chlorotic yellows virus (CCYV; genus Crinivirus, family Closteroviridae). Two melon plants were found exhibiting interveinal yellowing and chlorotic spot symptoms similar to those caused by a crinivirus, but varying from symptoms normally observed during infection by Cucurbit yellow stunting disorder virus (CYSDV; genus Crinivirus). Further studies will be necessary to evaluate epidemiology of CCYV in the southwestern U.S. desert production region, and to determine its impact on melon production and development of crinivirus-resistant cultivars. (See Wintermantel et al. 2019). To this end, a multiplex primer system has been developed to allow detection and differentiation of CCYV, CYSDV, SqVYV, and the aphid-transmitted polerovirus, Cucurbit aphid-borne yellows virus (CABYV) which produces symptoms identical to those of CCYV and CYSDV on cucurbit plants (Figure 6). Similarly, a RT-qPCR primer set was also developed for single reaction quantification of CCYV, CYSDV and SqVYV that allows determination of concentrations for each virus in melon breeding lines (not shown). These primer sets can also be used on other cucurbit crop plants for resistance evaluation.
Figure 6. Single test detection of four major viruses impacting U.S. cucurbit production: CYSDV, CCYV, SqVYV, and CABYV.
view figure 6 on page 51 of the pdf version of this document
The multiplex RT-PCR system identified a prevalence of CCYV in limited Spring sampling in 2019, where all yellowed melons were positive for CCYV, and two had mixed infection of CCYV and CYSDV. No other whitefly-transmitted viruses were identified in the spring sampling. The purpose of the limited spring sampling was primarily to evaluate the performance of the new multiplex detection systems and therefore was limited in scope.
Results of a more extensive fall sampling of melons crops throughout the western Arizona and southern California desert production regions demonstrated an abundance of CYSDV among the Fall melon samples from throughout the region with 76 % of plants sampled (26/34 plants) testing positive for CYSDV (Table 3). CCYV was also detected in 38 % of plants tested, and in 50 % (13/26) of the CYSDV infected plants. No single infections of CCYV were identified during the fall season. Some melon fields had nearly universal co-infection of both CYSDV and CCYV. SqVYV was detected in 24 % of plants tested (8/34), and in 31 % of the CYSDV infected plants. Like CCYV, all SqVYV infected plants were also co-infected with CYSDV. Interestingly, all SqVYV-infected plants were from Arizona; no SqVYV was detected in samples collected from California in the fall of 2019. CABYV is aphid-transmitted and symptoms resemble those of CYSDV and CCYV, which is why it was included in the multiplex detection system. CABYV is more prevalent in the Central Valley of California than in the Low Desert region, but we did identify four melon samples with CABYV infections, all from Arizona. Three of these melon plants were infected with CABYV alone, whereas one was co-infected with CYSDV. These results strongly suggest CYSDV remains the dominant virus in the region during the Fall season, and contrasted with the results of the more limited Spring sampling in which CCYV was by far the most prevalent of the viruses.
Table 3. Virus incidence among commercial fields and research plots1 in low desert production regions of California and Arizona sampled in September 2019.
Sample # |
CYSDV |
CCYV |
SqVYV |
CABYV |
| 1 | +2 | – | – | – |
| 2 | + | – | – | – |
| 3 | + | – | + | – |
| 4 | + | – | + | – |
| 5 | + | – | – | – |
| 6 | + | – | – | – |
| 7 | + | + | + | – |
| 8 | + | + | – | – |
| 9 | + | + | – | – |
| 10 | + | – | + | – |
| 11 | + | + | – | – |
| 12 | + | + | + | – |
| 13 | – | – | – | – |
| 14 | + | – | + | – |
| 15 | + | + | – | – |
| 16 | – | – | – | – |
| 17 | + | – | + | – |
| 18 | + | – | + | – |
| 19 | – | – | – | – |
| 20 | – | – | – | – |
| 21 | – | – | – | + |
| 22 | – | – | – | + |
| 23 | – | – | – | + |
| 24 | + | – | – | |
| 25 | + | – | – | + |
| 26 | – | – | – | – |
| 27 | + | + | – | – |
| 28 | + | – | – | – |
| 29 | + | + | – | – |
| 30 | + | + | – | – |
| 31 | + | + | – | – |
| 32 | + | + | – | – |
| 33 | + | + | – | – |
| 34 | + | + | – | – |
| CYSDV positive | + | – | – | – |
| CCYV positive | – | + | – | – |
| SqVYV positive | – | – | + | – |
| CABYV positive | – | – | – | + |
1 Not including results at DREC.
2 + = positive, – = negative
Introgress resistance into advanced breeding lines
Generated backcross populations of USVL206 (Majik Melon) x Top Mark and USVL206 (Majik Melon) x Charentais.
Making selections from the backcross populations using KASP markers for a subsequent BC2 populations.
KASP selection will identify individuals with all resistant markers, as well as select resistances for use in developing additional KASP validation populations and fine mapping analysis.
